lasergene seqman pro v 7 1 0 (DNASTAR)
DNASTAR is a verified supplier 
DNASTAR manufactures this product 
97
Structured Review
DNASTAR
lasergene seqman pro v 7 1 0
Lasergene Seqman Pro V 7 1 0, supplied by DNASTAR, used in various techniques. Bioz Stars score: 97/100, based on 2798 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pro+v%2E+7%2E1%2E0/SeqMan+Pro/10__3897_slash_mycokeys__130__170601-71-13-12
Average 97 stars, based on 2798 article reviews
Lasergene Seqman Pro V 7 1 0, supplied by DNASTAR, used in various techniques. Bioz Stars score: 97/100, based on 2798 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pro+v%2E+7%2E1%2E0/SeqMan+Pro/10__3897_slash_mycokeys__130__170601-71-13-12
Average 97 stars, based on 2798 article reviews
lasergene seqman pro v 7 1 0 - by Bioz Stars,
2026-09
97/100 stars
Images
Related Articles
Sequencing:Article Title: Ascodipteron sanmingensis sp. nov., a new bat fly ( Hippoboscidae : streblid grade) from Fujian, China Article Snippet: Article Title: Proposal of a new family Pseudodiploösporeaceae fam. nov. ( Hypocreales ) based on phylogeny of Diploöspora longispora and Paecilomyces penicillatus Article Snippet: Article Title: From oral structure to molecular evidence: new insights into the evolutionary phylogeny of the ciliate order Sessilida (Protista, Ciliophora), with the establishment of two new families and new contributions to the poorly studied family Vaginicolidae. Article Snippet: The contigs were assembled with Article Title: A newly emerging alphasatellite affects banana bunchy top virus replication, transcription, siRNA production and transmission by aphids Article Snippet: All the resulting Velvet contigs were scaffolded using Article Title: Molecular Characterization of a Natural Mutant of Feline Calicivirus in China Article Snippet: Page 4/9 Primer name Nucleotide sequence(5’-3’)a Nt positions b Amplicon size(bp) FCV363-F FCV363-R ATTCGGARTGGGAGGCTTT GTRTCAGTRTCRGACATAAR 5808- 6171 363 FCV1F FCV1R GTAAAAGAAATTTGAGACAATGTCTC TTACCACATGTTGATTGGCGGGTA 1-2451 2451 FCV2F FCV2R CTCCCCCTCCTACCTTTCTTAAC ATCTTTCCTGCCTGATCCCAATGCATGGGT 1987- 5601 3614 FCV3F FCV3R ATGTGCTCAACCTGCGCTAAC CCCTGGGGTTAGGCGCA 5321- 7700 2380 FCV3’UTR AATTGAATTTAGCGGCCGCGAATTGGCCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT aNucleotide sequences are shown using the single-letter IUB codes for degeneracy: R=A/G purine; Y=T/C pyrimidine; K=T/G. b The positions of primers were determined according to the complete genome sequence of FCV strain FCV-SH (GenBank accession no. KP987265) Nucleotide sequences assemble and Sequence analysis The obtained partial-genome sequences were sequenced at least three times and assembled using Article Title: Complete Genome Sequence of a Natural Mutant of Feline Calicivirus Isolated From a Stray Cat Article Snippet: The obtained partial-genome sequences were sequenced at least three times and assembled using Article Title: A New Species of Ascodipteron (Diptera: Hippoboscidae) from China Based on Morphology and DNA Barcodes Article Snippet: Article Title: Ultrastructural Variations of Antennae and Labia Are Associated with Feeding Habit Shifts in Stink Bugs (Heteroptera: Pentatomidae) Article Snippet: The sequences were assembled using Amplification:Article Title: Ascodipteron sanmingensis sp. nov., a new bat fly ( Hippoboscidae : streblid grade) from Fujian, China Article Snippet: Article Title: Proposal of a new family Pseudodiploösporeaceae fam. nov. ( Hypocreales ) based on phylogeny of Diploöspora longispora and Paecilomyces penicillatus Article Snippet: Article Title: From oral structure to molecular evidence: new insights into the evolutionary phylogeny of the ciliate order Sessilida (Protista, Ciliophora), with the establishment of two new families and new contributions to the poorly studied family Vaginicolidae. Article Snippet: The contigs were assembled with Article Title: A newly emerging alphasatellite affects banana bunchy top virus replication, transcription, siRNA production and transmission by aphids Article Snippet: All the resulting Velvet contigs were scaffolded using Article Title: Molecular Characterization of a Natural Mutant of Feline Calicivirus in China Article Snippet: Page 4/9 Primer name Nucleotide sequence(5’-3’)a Nt positions b Amplicon size(bp) FCV363-F FCV363-R ATTCGGARTGGGAGGCTTT GTRTCAGTRTCRGACATAAR 5808- 6171 363 FCV1F FCV1R GTAAAAGAAATTTGAGACAATGTCTC TTACCACATGTTGATTGGCGGGTA 1-2451 2451 FCV2F FCV2R CTCCCCCTCCTACCTTTCTTAAC ATCTTTCCTGCCTGATCCCAATGCATGGGT 1987- 5601 3614 FCV3F FCV3R ATGTGCTCAACCTGCGCTAAC CCCTGGGGTTAGGCGCA 5321- 7700 2380 FCV3’UTR AATTGAATTTAGCGGCCGCGAATTGGCCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT aNucleotide sequences are shown using the single-letter IUB codes for degeneracy: R=A/G purine; Y=T/C pyrimidine; K=T/G. b The positions of primers were determined according to the complete genome sequence of FCV strain FCV-SH (GenBank accession no. KP987265) Nucleotide sequences assemble and Sequence analysis The obtained partial-genome sequences were sequenced at least three times and assembled using Article Title: Complete Genome Sequence of a Natural Mutant of Feline Calicivirus Isolated From a Stray Cat Article Snippet: The obtained partial-genome sequences were sequenced at least three times and assembled using Article Title: A New Species of Ascodipteron (Diptera: Hippoboscidae) from China Based on Morphology and DNA Barcodes Article Snippet: Article Title: Ultrastructural Variations of Antennae and Labia Are Associated with Feeding Habit Shifts in Stink Bugs (Heteroptera: Pentatomidae) Article Snippet: The sequences were assembled using |